Transcript: Mouse XM_006505079.3

PREDICTED: Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 9A (Ppp1r9a), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r9a (243725)
Length:
9571
CDS:
375..3662

Additional Resources:

NCBI RefSeq record:
XM_006505079.3
NBCI Gene record:
Ppp1r9a (243725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413510 ACACCATTGTAGGCGGTTAAA pLKO_005 3768 3UTR 100% 13.200 18.480 N Ppp1r9a n/a
2 TRCN0000105984 GATTCGTTATTGGACGAGAAA pLKO.1 2131 CDS 100% 4.950 6.930 N Ppp1r9a n/a
3 TRCN0000105982 GCTGAGGTGTTCAGACTACTA pLKO.1 2820 CDS 100% 4.950 6.930 N Ppp1r9a n/a
4 TRCN0000105980 CCTCTTATATTGCGTTTCTTA pLKO.1 5863 3UTR 100% 5.625 4.500 N Ppp1r9a n/a
5 TRCN0000420730 GTTTAGTTGTGCTCCGATTAA pLKO_005 1751 CDS 100% 13.200 9.240 N Ppp1r9a n/a
6 TRCN0000105981 CCCTCAATTTACCATCTGTTA pLKO.1 1078 CDS 100% 4.950 3.465 N Ppp1r9a n/a
7 TRCN0000105983 GCCCAAAGAGTTTGTGGAGAA pLKO.1 677 CDS 100% 4.050 2.835 N Ppp1r9a n/a
8 TRCN0000438016 GGCCGTCTCAAGGATTCTAAT pLKO_005 1122 CDS 100% 13.200 7.920 N Ppp1r9a n/a
9 TRCN0000337043 GGGTGAGATCCAGGTATAATT pLKO_005 1591 CDS 100% 15.000 10.500 N PPP1R9A n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7915 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.