Transcript: Mouse XM_006505082.2

PREDICTED: Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 9A (Ppp1r9a), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r9a (243725)
Length:
3429
CDS:
390..3071

Additional Resources:

NCBI RefSeq record:
XM_006505082.2
NBCI Gene record:
Ppp1r9a (243725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105984 GATTCGTTATTGGACGAGAAA pLKO.1 2146 CDS 100% 4.950 6.930 N Ppp1r9a n/a
2 TRCN0000105982 GCTGAGGTGTTCAGACTACTA pLKO.1 2901 CDS 100% 4.950 6.930 N Ppp1r9a n/a
3 TRCN0000420730 GTTTAGTTGTGCTCCGATTAA pLKO_005 1766 CDS 100% 13.200 9.240 N Ppp1r9a n/a
4 TRCN0000105981 CCCTCAATTTACCATCTGTTA pLKO.1 1093 CDS 100% 4.950 3.465 N Ppp1r9a n/a
5 TRCN0000105983 GCCCAAAGAGTTTGTGGAGAA pLKO.1 692 CDS 100% 4.050 2.835 N Ppp1r9a n/a
6 TRCN0000438016 GGCCGTCTCAAGGATTCTAAT pLKO_005 1137 CDS 100% 13.200 7.920 N Ppp1r9a n/a
7 TRCN0000337043 GGGTGAGATCCAGGTATAATT pLKO_005 1606 CDS 100% 15.000 10.500 N PPP1R9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.