Transcript: Mouse XM_006505112.1

PREDICTED: Mus musculus Ca2+-dependent activator protein for secretion 2 (Cadps2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cadps2 (320405)
Length:
4943
CDS:
280..4173

Additional Resources:

NCBI RefSeq record:
XM_006505112.1
NBCI Gene record:
Cadps2 (320405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119993 GCGCTGCAAATGTTCGTCTTT pLKO.1 3334 CDS 100% 4.950 6.930 N Cadps2 n/a
2 TRCN0000423896 GTCGGAACCACAGGAATTAAT pLKO_005 1878 CDS 100% 15.000 12.000 N Cadps2 n/a
3 TRCN0000444877 TGGTGTGCCTCCCACTTATAA pLKO_005 4595 3UTR 100% 15.000 12.000 N Cadps2 n/a
4 TRCN0000413354 TAATGGCCAGTGATATGATAG pLKO_005 3410 CDS 100% 10.800 7.560 N Cadps2 n/a
5 TRCN0000119994 CCCAGATTCATCTCGAAAGAA pLKO.1 1168 CDS 100% 5.625 3.938 N Cadps2 n/a
6 TRCN0000119996 CCCAAGGAGATTTCAACACTA pLKO.1 1523 CDS 100% 4.950 3.465 N Cadps2 n/a
7 TRCN0000119992 CCCATGACACAGCATTGTGAA pLKO.1 4523 3UTR 100% 4.950 3.465 N Cadps2 n/a
8 TRCN0000119995 GCTCCATTACAGCTTTGCATT pLKO.1 2421 CDS 100% 4.950 3.465 N Cadps2 n/a
9 TRCN0000161289 GCTCCATTACAGCTTTGCATT pLKO.1 2421 CDS 100% 4.950 3.465 N CADPS2 n/a
10 TRCN0000161315 GCAGTTACTGAAAGAACGGTT pLKO.1 645 CDS 100% 2.640 1.848 N CADPS2 n/a
11 TRCN0000160329 CCAACTTCTAATAGCTCCAAA pLKO.1 1639 CDS 100% 4.950 3.960 N CADPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.