Transcript: Mouse XM_006505283.1

PREDICTED: Mus musculus chromodomain helicase DNA binding protein 4 (Chd4), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chd4 (107932)
Length:
6761
CDS:
355..6171

Additional Resources:

NCBI RefSeq record:
XM_006505283.1
NBCI Gene record:
Chd4 (107932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086143 GCCCATCTTCTGAGTTGTAAA pLKO.1 6275 3UTR 100% 13.200 18.480 N Chd4 n/a
2 TRCN0000301935 GCCCATCTTCTGAGTTGTAAA pLKO_005 6275 3UTR 100% 13.200 18.480 N Chd4 n/a
3 TRCN0000311040 GTATATTCTCACGCGGAATTT pLKO_005 3276 CDS 100% 13.200 10.560 N Chd4 n/a
4 TRCN0000311050 TCGAGTGAGGACGACGATTTA pLKO_005 1279 CDS 100% 13.200 10.560 N Chd4 n/a
5 TRCN0000086145 CCTGCGGAATGATAAAGATAA pLKO.1 4572 CDS 100% 13.200 9.240 N Chd4 n/a
6 TRCN0000304565 GAACGTGGTGATGGATCTTAA pLKO_005 3342 CDS 100% 13.200 9.240 N Chd4 n/a
7 TRCN0000086146 CCTGAGAGGTTCCACAACTTA pLKO.1 3076 CDS 100% 5.625 3.938 N Chd4 n/a
8 TRCN0000086144 GCCTGCGGAATGATAAAGATA pLKO.1 4571 CDS 100% 5.625 3.938 N Chd4 n/a
9 TRCN0000086147 GCTCGAAGATTCAAGCTCTTA pLKO.1 5776 CDS 100% 4.950 3.465 N Chd4 n/a
10 TRCN0000301995 GCTCGAAGATTCAAGCTCTTA pLKO_005 5776 CDS 100% 4.950 3.465 N Chd4 n/a
11 TRCN0000380822 GCTACCTCTGTTGGCATCTTT pLKO_005 6597 3UTR 100% 5.625 3.375 N CHD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.