Transcript: Mouse XM_006505320.3

PREDICTED: Mus musculus forkhead box P1 (Foxp1), transcript variant X17, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Foxp1 (108655)
Length:
12280
CDS:
5799..7532

Additional Resources:

NCBI RefSeq record:
XM_006505320.3
NBCI Gene record:
Foxp1 (108655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244822 TGGTAACCCTTCCCTTATTAA pLKO_005 7148 CDS 100% 15.000 21.000 N FOXP1 n/a
2 TRCN0000321565 TGGTAACCCTTCCCTTATTAA pLKO_005 7148 CDS 100% 15.000 21.000 N Foxp1 n/a
3 TRCN0000072003 CGGAAGTTAGACCACCATTTA pLKO.1 6883 CDS 100% 13.200 10.560 N Foxp1 n/a
4 TRCN0000321612 AGCTCAATGTAGAGTACAAAT pLKO_005 6512 CDS 100% 13.200 9.240 N Foxp1 n/a
5 TRCN0000321550 CGCCAAGGCCTCCTAACAATT pLKO_005 6099 CDS 100% 13.200 9.240 N Foxp1 n/a
6 TRCN0000321549 GTGCGAGTAGAGAACGTTAAA pLKO_005 7068 CDS 100% 13.200 9.240 N Foxp1 n/a
7 TRCN0000072005 GCTAACACTAAACGAAATCTA pLKO.1 6953 CDS 100% 5.625 3.938 N Foxp1 n/a
8 TRCN0000072006 GCTTACCTCATACTCCAACAA pLKO.1 6703 CDS 100% 4.950 3.465 N Foxp1 n/a
9 TRCN0000072004 CCTCAGGTTATCACTCCTCAA pLKO.1 5808 CDS 100% 4.050 2.430 N Foxp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.