Transcript: Mouse XM_006505579.1

PREDICTED: Mus musculus THUMP domain containing 3 (Thumpd3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Thumpd3 (14911)
Length:
2338
CDS:
369..1886

Additional Resources:

NCBI RefSeq record:
XM_006505579.1
NBCI Gene record:
Thumpd3 (14911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277219 AGACCGCGGAAAGATCTATTT pLKO_005 578 CDS 100% 13.200 18.480 N Thumpd3 n/a
2 TRCN0000177331 GATTCACATATCTTGGACTAT pLKO.1 915 CDS 100% 4.950 6.930 N Thumpd3 n/a
3 TRCN0000177714 CAGTTCAAAGATACGAAGGAA pLKO.1 687 CDS 100% 3.000 4.200 N Thumpd3 n/a
4 TRCN0000277220 CAATGAGGCTGCGAGAGATTT pLKO_005 1100 CDS 100% 13.200 10.560 N Thumpd3 n/a
5 TRCN0000277221 GTGCTATTCAAGAGTACTTTA pLKO_005 1126 CDS 100% 13.200 9.240 N Thumpd3 n/a
6 TRCN0000200212 CCTACACTGCTTGGCTTCTAA pLKO.1 2067 3UTR 100% 5.625 3.938 N Thumpd3 n/a
7 TRCN0000200253 CCATGTAGTCTGGGTGAACAT pLKO.1 1769 CDS 100% 4.950 3.465 N Thumpd3 n/a
8 TRCN0000178494 CTATTGACTAAGAGCCAGATT pLKO.1 1470 CDS 100% 4.950 3.465 N Thumpd3 n/a
9 TRCN0000320150 CTATTGACTAAGAGCCAGATT pLKO_005 1470 CDS 100% 4.950 3.465 N Thumpd3 n/a
10 TRCN0000178211 GCAAGGTGATTGTAATGGTAT pLKO.1 2035 3UTR 100% 4.950 3.465 N Thumpd3 n/a
11 TRCN0000277162 GCAAGGTGATTGTAATGGTAT pLKO_005 2035 3UTR 100% 4.950 3.465 N Thumpd3 n/a
12 TRCN0000182670 GCCTTATCTGGAATGGGACAT pLKO.1 1734 CDS 100% 4.050 2.835 N Thumpd3 n/a
13 TRCN0000177230 GAAGAAGTTCTAAGAGACTTT pLKO.1 705 CDS 100% 4.950 2.970 N Thumpd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.