Transcript: Mouse XM_006505617.3

PREDICTED: Mus musculus interleukin 12 receptor, beta 2 (Il12rb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Il12rb2 (16162)
Length:
3841
CDS:
331..2955

Additional Resources:

NCBI RefSeq record:
XM_006505617.3
NBCI Gene record:
Il12rb2 (16162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067720 CCAGACAACTAGTGAACCTAT pLKO.1 2642 CDS 100% 0.000 0.000 N Il12rb2 n/a
2 TRCN0000067721 GCTGCTGATTAAAGCAAATAT pLKO.1 384 CDS 100% 15.000 10.500 N Il12rb2 n/a
3 TRCN0000067722 CCCAAGGAAATGAAAGGGAAT pLKO.1 2198 CDS 100% 4.050 2.835 N Il12rb2 n/a
4 TRCN0000067719 GCTCTGATTTCAGAGAACATA pLKO.1 1822 CDS 100% 0.563 0.394 N Il12rb2 n/a
5 TRCN0000067718 CCAGGTTCATAGTCCGTGTTA pLKO.1 959 CDS 100% 4.950 2.970 N Il12rb2 n/a
6 TRCN0000418759 AGAACCATTCCAGATCCAGAA pLKO_005 2365 CDS 100% 4.050 2.835 N CWC25 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3208 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.