Transcript: Mouse XM_006505622.2

PREDICTED: Mus musculus leucine-rich repeats and immunoglobulin-like domains 1 (Lrig1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrig1 (16206)
Length:
4359
CDS:
640..3129

Additional Resources:

NCBI RefSeq record:
XM_006505622.2
NBCI Gene record:
Lrig1 (16206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313912 GGAATCGGATTCGGCTGATTG pLKO_005 518 5UTR 100% 10.800 15.120 N Lrig1 n/a
2 TRCN0000313982 TAGACGATGCAGGGCGGTATA pLKO_005 2123 CDS 100% 10.800 15.120 N Lrig1 n/a
3 TRCN0000108504 CTGACACAACTAGACCTGAAT pLKO.1 496 5UTR 100% 4.950 6.930 N Lrig1 n/a
4 TRCN0000313915 CCAACAACATCACGGAAATTC pLKO_005 302 5UTR 100% 13.200 10.560 N Lrig1 n/a
5 TRCN0000108500 CCATAGTTGATGGTTAATGTT pLKO.1 4151 3UTR 100% 5.625 4.500 N Lrig1 n/a
6 TRCN0000108502 GCGTCACTAACACAGATGAAA pLKO.1 2336 CDS 100% 5.625 4.500 N Lrig1 n/a
7 TRCN0000317502 GCGTCACTAACACAGATGAAA pLKO_005 2336 CDS 100% 5.625 4.500 N Lrig1 n/a
8 TRCN0000313913 AGAAACGTGAGAGACTATTTG pLKO_005 3279 3UTR 100% 13.200 9.240 N Lrig1 n/a
9 TRCN0000108503 GCCATCAGTCACATTGCTGAA pLKO.1 883 CDS 100% 4.050 2.430 N Lrig1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.