Transcript: Mouse XM_006505672.2

PREDICTED: Mus musculus vomeronasal 1 receptor 4 (Vmn1r4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r4 (171194)
Length:
1202
CDS:
107..1000

Additional Resources:

NCBI RefSeq record:
XM_006505672.2
NBCI Gene record:
Vmn1r4 (171194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120210 GAGTGAGAACAAACAGATAAT pLKO.1 559 CDS 100% 13.200 9.240 N Vmn1r4 n/a
2 TRCN0000120207 CAAACAGATAATGGTCACTAA pLKO.1 568 CDS 100% 4.950 3.465 N Vmn1r4 n/a
3 TRCN0000429777 ACAATGACCATCTTAAGAGAC pLKO_005 638 CDS 100% 4.050 2.835 N Vmn1r4 n/a
4 TRCN0000426302 TTTCAATTTCTCTGTCAGTAC pLKO_005 502 CDS 100% 4.050 2.835 N Vmn1r4 n/a
5 TRCN0000120208 CTGTCAGTACTGACATAATAT pLKO.1 513 CDS 100% 1.500 1.050 N Vmn1r4 n/a
6 TRCN0000421820 GACCTGACTTCCTGCCAACTG pLKO_005 221 CDS 100% 1.350 0.945 N Vmn1r4 n/a
7 TRCN0000120211 GCATCACTGAACACTGAGAAT pLKO.1 302 CDS 100% 4.950 2.970 N Vmn1r4 n/a
8 TRCN0000120209 GCTGTCACAATCAGTCCCAAT pLKO.1 410 CDS 100% 4.050 2.025 Y Vmn1r4 n/a
9 TRCN0000181136 CCTATCCCACAATTACTCCTT pLKO.1 918 CDS 100% 2.640 1.320 Y Vmn1r32 n/a
10 TRCN0000175437 CAAGCATCTTCATAGCATCAA pLKO.1 733 CDS 100% 4.950 2.475 Y Vmn1r6 n/a
11 TRCN0000120170 GCATCTTCATAGCATCAGCTA pLKO.1 736 CDS 100% 2.640 1.320 Y Vmn1r29 n/a
12 TRCN0000175826 GTGGACTTCATCATCTCATTT pLKO.1 833 CDS 100% 13.200 6.600 Y Vmn1r8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.