Transcript: Mouse XM_006505728.3

PREDICTED: Mus musculus contactin 3 (Cntn3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cntn3 (18488)
Length:
6245
CDS:
1145..4231

Additional Resources:

NCBI RefSeq record:
XM_006505728.3
NBCI Gene record:
Cntn3 (18488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113646 CCACCCTTTGTCAGGTTATAT pLKO.1 4171 CDS 100% 15.000 21.000 N Cntn3 n/a
2 TRCN0000113645 CGGTGACAAATACCAGAGTAT pLKO.1 1746 CDS 100% 4.950 6.930 N Cntn3 n/a
3 TRCN0000113647 CCCTGTTGATTCAGAGGACAA pLKO.1 1255 CDS 100% 4.050 2.835 N Cntn3 n/a
4 TRCN0000113649 CCTTACAATAACCAACCTCAA pLKO.1 2254 CDS 100% 4.050 2.835 N Cntn3 n/a
5 TRCN0000113648 CCATTTCTAACATCCACCCTT pLKO.1 4158 CDS 100% 2.640 1.848 N Cntn3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4611 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.