Transcript: Mouse XM_006505766.3

PREDICTED: Mus musculus RAD52 homolog, DNA repair protein (Rad52), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rad52 (19365)
Length:
2256
CDS:
636..1724

Additional Resources:

NCBI RefSeq record:
XM_006505766.3
NBCI Gene record:
Rad52 (19365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375250 TACGTGGGAGTCTGTGCATTT pLKO_005 948 CDS 100% 10.800 15.120 N Rad52 n/a
2 TRCN0000124108 GCCAGTATACAGCGGATGAAT pLKO.1 724 CDS 100% 5.625 7.875 N Rad52 n/a
3 TRCN0000124105 GCATTTGTAAAGGTGCAGTTA pLKO.1 963 CDS 100% 4.950 6.930 N Rad52 n/a
4 TRCN0000018870 CGGGTAATTAATCTGGCCAAT pLKO.1 846 CDS 100% 4.050 5.670 N RAD52 n/a
5 TRCN0000277235 CAGACTTAGAGGACATCATTA pLKO_005 1459 CDS 100% 13.200 10.560 N Rad52 n/a
6 TRCN0000375252 GACTGGGTCCAGAGTACATTA pLKO_005 775 CDS 100% 13.200 10.560 N Rad52 n/a
7 TRCN0000375186 TCCCTCTTGATGTGGATTTAA pLKO_005 988 CDS 100% 15.000 10.500 N Rad52 n/a
8 TRCN0000233362 TTGAAGGTCATCGGGTAATTA pLKO_005 835 CDS 100% 15.000 10.500 N Rad52 n/a
9 TRCN0000124107 CATTTGTAAAGGTGCAGTTAA pLKO.1 964 CDS 100% 13.200 9.240 N Rad52 n/a
10 TRCN0000233361 CCAGTATACAGCGGATGAATA pLKO_005 725 CDS 100% 13.200 9.240 N Rad52 n/a
11 TRCN0000375184 CCCACATGACTCGAACATTAA pLKO_005 1133 CDS 100% 13.200 9.240 N Rad52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.