Transcript: Mouse XM_006505771.2

PREDICTED: Mus musculus transient receptor potential cation channel, subfamily V, member 5 (Trpv5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trpv5 (194352)
Length:
3377
CDS:
94..1908

Additional Resources:

NCBI RefSeq record:
XM_006505771.2
NBCI Gene record:
Trpv5 (194352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068764 CGTTGGTTCTTACGGGTTGAA pLKO.1 1597 CDS 100% 4.950 6.930 N Trpv5 n/a
2 TRCN0000068766 GCTATGGTCATCCTGGGATTT pLKO.1 1207 CDS 100% 10.800 7.560 N Trpv5 n/a
3 TRCN0000009931 CACTGCTCATGCTCAACTTGT pLKO.1 1415 CDS 100% 4.950 3.465 N TRPV5 n/a
4 TRCN0000068763 CCTGCCAATTACAGAGTGGAT pLKO.1 1345 CDS 100% 2.640 1.848 N Trpv5 n/a
5 TRCN0000068767 GCTGTAATTATTCTACTCCTA pLKO.1 901 CDS 100% 2.640 1.848 N Trpv5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.