Transcript: Mouse XM_006505805.2

PREDICTED: Mus musculus rhotekin (Rtkn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rtkn (20166)
Length:
2374
CDS:
356..2275

Additional Resources:

NCBI RefSeq record:
XM_006505805.2
NBCI Gene record:
Rtkn (20166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322093 TGGTGTGCAACAGCCGTATTC pLKO_005 714 CDS 100% 10.800 15.120 N Rtkn n/a
2 TRCN0000322030 GTGGAAGGATACAGAGTATTT pLKO_005 880 CDS 100% 13.200 9.240 N Rtkn n/a
3 TRCN0000322028 CAAGAACCACTGTTCACTATC pLKO_005 1541 CDS 100% 10.800 7.560 N Rtkn n/a
4 TRCN0000181058 CAAGATGGATTCCGTACACAT pLKO.1 1295 CDS 100% 4.950 3.465 N Rtkn n/a
5 TRCN0000184056 CAGCCGTATTCTCAGCTACAT pLKO.1 724 CDS 100% 4.950 3.465 N Rtkn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.