Transcript: Mouse XM_006505820.3

PREDICTED: Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 5 (St3gal5), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St3gal5 (20454)
Length:
2126
CDS:
233..1225

Additional Resources:

NCBI RefSeq record:
XM_006505820.3
NBCI Gene record:
St3gal5 (20454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304995 TGCACCTCTTCGTCCTATTTA pLKO_005 1399 3UTR 100% 15.000 21.000 N St3gal5 n/a
2 TRCN0000077111 GACGTTGAATACTACGCCAAT pLKO.1 731 CDS 100% 4.050 3.240 N St3gal5 n/a
3 TRCN0000302841 GACGTTGAATACTACGCCAAT pLKO_005 731 CDS 100% 4.050 3.240 N St3gal5 n/a
4 TRCN0000077110 CGATGTGGTAATAAGGTTGAA pLKO.1 625 CDS 100% 4.950 3.465 N St3gal5 n/a
5 TRCN0000302842 CGATGTGGTAATAAGGTTGAA pLKO_005 625 CDS 100% 4.950 3.465 N St3gal5 n/a
6 TRCN0000222636 CAGCATCAACTTGGAGCCTTT pLKO.1 388 CDS 100% 4.050 2.835 N St3gal5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.