Transcript: Mouse XM_006505829.2

PREDICTED: Mus musculus stimulated by retinoic acid gene 8 (Stra8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stra8 (20899)
Length:
1413
CDS:
121..1239

Additional Resources:

NCBI RefSeq record:
XM_006505829.2
NBCI Gene record:
Stra8 (20899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216621 GAATAGGACAAAGATTCATAT pLKO.1 261 CDS 100% 13.200 10.560 N Stra8 n/a
2 TRCN0000182159 CCGGACCTCATGGAATTTGAA pLKO.1 676 CDS 100% 5.625 4.500 N Stra8 n/a
3 TRCN0000198820 CGAGAATGACAGTGTATTCCT pLKO.1 399 CDS 100% 3.000 2.400 N Stra8 n/a
4 TRCN0000182007 CGGAGAAGGAGGAGATTAAAT pLKO.1 1251 3UTR 100% 15.000 10.500 N Stra8 n/a
5 TRCN0000178313 GCTGTGTTAACACTCCATTAA pLKO.1 1145 CDS 100% 13.200 9.240 N Stra8 n/a
6 TRCN0000215386 CATGAAGTGACACTTCCTATT pLKO.1 760 CDS 100% 10.800 7.560 N Stra8 n/a
7 TRCN0000178496 CAGCTCTACATACAGATCATT pLKO.1 1105 CDS 100% 5.625 3.938 N Stra8 n/a
8 TRCN0000181621 GAAGCTCAAAGCATCCTTCAA pLKO.1 315 CDS 100% 4.950 3.465 N Stra8 n/a
9 TRCN0000217050 CTAACATCAGCGCTATGTTTG pLKO.1 1049 CDS 100% 1.080 0.756 N Stra8 n/a
10 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 514 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.