Transcript: Mouse XM_006505917.2

PREDICTED: Mus musculus Von Willebrand factor (Vwf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vwf (22371)
Length:
8843
CDS:
257..8707

Additional Resources:

NCBI RefSeq record:
XM_006505917.2
NBCI Gene record:
Vwf (22371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080068 GCGCTATGTAACTTCACAAAT pLKO.1 5599 CDS 100% 13.200 18.480 N Vwf n/a
2 TRCN0000080070 CCCACCATTTGATGAACACAA pLKO.1 8344 CDS 100% 4.950 6.930 N Vwf n/a
3 TRCN0000080071 GCCAGAGTCTTCCTTTGATAA pLKO.1 5371 CDS 100% 13.200 9.240 N Vwf n/a
4 TRCN0000080072 GCAGTGGTAGAGTACCATGAT pLKO.1 4214 CDS 100% 4.950 3.465 N Vwf n/a
5 TRCN0000080069 GCTAGGAATTTGGTCCGCTAT pLKO.1 4445 CDS 100% 4.050 2.835 N Vwf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.