Transcript: Mouse XM_006505943.3

PREDICTED: Mus musculus JAZF zinc finger 1 (Jazf1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jazf1 (231986)
Length:
2942
CDS:
153..803

Additional Resources:

NCBI RefSeq record:
XM_006505943.3
NBCI Gene record:
Jazf1 (231986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078534 GCGGCACCACACAATCAATTT pLKO.1 737 CDS 100% 13.200 10.560 N JAZF1 n/a
2 TRCN0000127432 GAATGTGAATGGCATAAAGTA pLKO.1 626 CDS 100% 5.625 4.500 N Jazf1 n/a
3 TRCN0000256875 CAAGAATGTGAATGGCATAAA pLKO_005 623 CDS 100% 13.200 9.240 N JAZF1 n/a
4 TRCN0000127429 GCCCTTTAAGAAGCTGAAATT pLKO.1 1409 3UTR 100% 13.200 9.240 N Jazf1 n/a
5 TRCN0000256870 TCAGCTCCATGTGCATGAATG pLKO_005 550 CDS 100% 10.800 7.560 N JAZF1 n/a
6 TRCN0000127430 CCTCAGTTACATCAATAGATT pLKO.1 242 CDS 100% 5.625 3.938 N Jazf1 n/a
7 TRCN0000127433 CGCGTCCGCAAACCATTCAAA pLKO.1 678 CDS 100% 5.625 3.938 N Jazf1 n/a
8 TRCN0000127431 CACCACACAATCAATTTCCAT pLKO.1 741 CDS 100% 3.000 2.100 N Jazf1 n/a
9 TRCN0000078536 GCACCACACAATCAATTTCCA pLKO.1 740 CDS 100% 3.000 2.100 N JAZF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.