Transcript: Mouse XM_006505995.1

PREDICTED: Mus musculus histone deacetylase 11 (Hdac11), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hdac11 (232232)
Length:
2200
CDS:
95..772

Additional Resources:

NCBI RefSeq record:
XM_006505995.1
NBCI Gene record:
Hdac11 (232232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339502 GAAGCGCACAGCCCGTATTAT pLKO_005 643 CDS 100% 15.000 21.000 N Hdac11 n/a
2 TRCN0000377043 ACGGCTACTCACAGAACATTG pLKO_005 772 CDS 100% 10.800 15.120 N Hdac11 n/a
3 TRCN0000339501 TGGTCCGAGCCCATGATATAC pLKO_005 591 CDS 100% 13.200 10.560 N Hdac11 n/a
4 TRCN0000039227 CGAGTATACATCATGGATGTT pLKO.1 317 CDS 100% 4.950 3.960 N Hdac11 n/a
5 TRCN0000039225 CCATGATATACCCATCCTCAT pLKO.1 601 CDS 100% 4.050 3.240 N Hdac11 n/a
6 TRCN0000339574 AGAGTCGTTTGCTGTTCATAT pLKO_005 1059 3UTR 100% 13.200 9.240 N Hdac11 n/a
7 TRCN0000339503 CATGGGTGACAAGCGAGTATA pLKO_005 304 CDS 100% 13.200 9.240 N Hdac11 n/a
8 TRCN0000377111 TTGGCTTACTTCCTCACTTTA pLKO_005 1109 3UTR 100% 13.200 9.240 N Hdac11 n/a
9 TRCN0000377110 AGACATCACACTGGCTATCAA pLKO_005 196 CDS 100% 5.625 3.938 N Hdac11 n/a
10 TRCN0000039224 GCCACCATCATTGATCTCGAT pLKO.1 251 CDS 100% 2.640 1.848 N Hdac11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.