Transcript: Mouse XM_006506155.1

PREDICTED: Mus musculus C-type lectin domain family 4, member a2 (Clec4a2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clec4a2 (26888)
Length:
1014
CDS:
59..655

Additional Resources:

NCBI RefSeq record:
XM_006506155.1
NBCI Gene record:
Clec4a2 (26888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077414 GTGCTACAATAATTTACCGTT pLKO.1 552 CDS 100% 2.640 3.696 N Clec4a2 n/a
2 TRCN0000077417 CCCAAAGGATTGGAGGCTATT pLKO.1 259 CDS 100% 10.800 6.480 N Clec4a2 n/a
3 TRCN0000412533 AGCCAGGAAGAGCAGGATTTC pLKO_005 383 CDS 100% 10.800 5.400 Y Clec4a2 n/a
4 TRCN0000422898 TGGGTTGATCAGACACCATAT pLKO_005 476 CDS 100% 10.800 5.400 Y Clec4a2 n/a
5 TRCN0000417165 CATCAGCATCTTGGAACAAGA pLKO_005 315 CDS 100% 4.950 2.475 Y Clec4b1 n/a
6 TRCN0000077421 GCTACTTGGTTCCCACAGTTT pLKO.1 291 CDS 100% 4.950 2.475 Y Clec4b1 n/a
7 TRCN0000077419 GCAGGATTTCATCACTGGGAT pLKO.1 394 CDS 100% 2.640 1.320 Y Clec4b1 n/a
8 TRCN0000077422 GCTCATCTAGTGGTGATCCAT pLKO.1 362 CDS 100% 3.000 1.500 Y Clec4b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.