Transcript: Mouse XM_006506181.3

PREDICTED: Mus musculus dysferlin (Dysf), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dysf (26903)
Length:
7035
CDS:
600..6806

Additional Resources:

NCBI RefSeq record:
XM_006506181.3
NBCI Gene record:
Dysf (26903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426062 AGGAATGCTTGGTCCGTATTT pLKO_005 5290 CDS 100% 13.200 18.480 N Dysf n/a
2 TRCN0000426903 AGATCACACTCTACGATTATG pLKO_005 5494 CDS 100% 13.200 10.560 N Dysf n/a
3 TRCN0000412835 TCGTGTTTCCCTTCGACTATC pLKO_005 6175 CDS 100% 10.800 8.640 N Dysf n/a
4 TRCN0000111756 CGGAGAATTTAAGGGTCTCTT pLKO.1 5189 CDS 100% 4.950 3.960 N Dysf n/a
5 TRCN0000429156 ACAACGTCAAGCAGATCTTTG pLKO_005 1804 CDS 100% 10.800 7.560 N Dysf n/a
6 TRCN0000111757 CCCGTACAAGACCATGAAGTT pLKO.1 6653 CDS 100% 4.950 3.465 N Dysf n/a
7 TRCN0000111755 CCCTGCTATGTGAACCTCTAT pLKO.1 2121 CDS 100% 4.950 3.465 N Dysf n/a
8 TRCN0000111759 CCTCTAGATCAGAGCTCAGAA pLKO.1 771 CDS 100% 4.950 3.465 N Dysf n/a
9 TRCN0000111758 CCCTTACATCAAGATCTCCAT pLKO.1 5363 CDS 100% 2.640 1.848 N Dysf n/a
10 TRCN0000000965 GCTGGAAATGACCTTGGAGAT pLKO.1 6515 CDS 100% 4.050 2.430 N DYSF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.