Transcript: Mouse XM_006506366.1

PREDICTED: Mus musculus RAB11 family interacting protein 5 (class I) (Rab11fip5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab11fip5 (52055)
Length:
5834
CDS:
121..3777

Additional Resources:

NCBI RefSeq record:
XM_006506366.1
NBCI Gene record:
Rab11fip5 (52055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297228 CTTGGGATGTGATCACCATTT pLKO_005 2252 CDS 100% 10.800 15.120 N Rab11fip5 n/a
2 TRCN0000279537 GACCAGCCAAGCACAAGTATG pLKO_005 1942 CDS 100% 10.800 15.120 N Rab11fip5 n/a
3 TRCN0000179516 GACGACACCTTCAACATCTTT pLKO.1 1723 CDS 100% 5.625 7.875 N Rab11fip5 n/a
4 TRCN0000028294 CGAAGAGTGTTCGTTCGAGCT pLKO.1 330 CDS 100% 2.160 3.024 N LOC384453 n/a
5 TRCN0000279582 GAATTGCAACAAGGTTGTTAG pLKO_005 3999 3UTR 100% 10.800 8.640 N Rab11fip5 n/a
6 TRCN0000297229 TCTAAGGAGGAATGGGTAAAT pLKO_005 2608 CDS 100% 13.200 9.240 N Rab11fip5 n/a
7 TRCN0000028271 CGGAATGGTGCGAAGAGTGTT pLKO.1 320 CDS 100% 4.950 3.465 N LOC384453 n/a
8 TRCN0000028252 TCGGTAGTGGAGAAGACGCAA pLKO.1 292 CDS 100% 2.640 1.848 N LOC384453 n/a
9 TRCN0000028227 GCCGAGAGAAGTACAGCACCT pLKO.1 272 CDS 100% 0.720 0.504 N LOC384453 n/a
10 TRCN0000028300 TGCCCACGCATGTCCAGGTGA pLKO.1 170 CDS 100% 0.000 0.000 N LOC384453 n/a
11 TRCN0000183996 CCTTGCTGTTTGGCTTCTCTA pLKO.1 5592 3UTR 100% 4.950 2.970 N Rab11fip5 n/a
12 TRCN0000011070 CAAGAGTAGCTGGTTTGGCTT pLKO.1 1611 CDS 100% 2.640 2.112 N RAB11FIP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.