Transcript: Mouse XM_006506384.2

PREDICTED: Mus musculus contactin 6 (Cntn6), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cntn6 (53870)
Length:
3846
CDS:
632..3667

Additional Resources:

NCBI RefSeq record:
XM_006506384.2
NBCI Gene record:
Cntn6 (53870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435972 ACTAAGAGCTAATACGATTTA pLKO_005 3184 CDS 100% 13.200 18.480 N Cntn6 n/a
2 TRCN0000420974 AGATCAAGATATTGGCATATA pLKO_005 853 CDS 100% 13.200 18.480 N Cntn6 n/a
3 TRCN0000440211 GTCGTTTCAGCCGTCCTATTT pLKO_005 693 CDS 100% 13.200 18.480 N Cntn6 n/a
4 TRCN0000413340 TGAAAGAGAGAACGATCATTA pLKO_005 2067 CDS 100% 13.200 10.560 N Cntn6 n/a
5 TRCN0000113582 GCTGCAAAGGATTCATCTATA pLKO.1 1295 CDS 100% 13.200 9.240 N Cntn6 n/a
6 TRCN0000113581 GCCTTAAGATATGCAATGTTA pLKO.1 1968 CDS 100% 5.625 3.938 N Cntn6 n/a
7 TRCN0000113580 CCAGCCTCTATCACAAGACAT pLKO.1 3726 3UTR 100% 4.950 3.465 N Cntn6 n/a
8 TRCN0000113583 CCAGTTAATGTCACCACCAAA pLKO.1 3257 CDS 100% 4.950 3.465 N Cntn6 n/a
9 TRCN0000113584 CCTTTCTATCTATGACAGCTT pLKO.1 1564 CDS 100% 2.640 1.848 N Cntn6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.