Transcript: Mouse XM_006506675.3

PREDICTED: Mus musculus zinc finger protein 777 (Zfp777), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp777 (72306)
Length:
1815
CDS:
19..1800

Additional Resources:

NCBI RefSeq record:
XM_006506675.3
NBCI Gene record:
Zfp777 (72306)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255264 CTCTATGGACTATGCAATATC pLKO_005 1113 CDS 100% 13.200 18.480 N Zfp777 n/a
2 TRCN0000225774 CGATGATGTCGCCGTCCATTT pLKO_005 1008 CDS 100% 10.800 15.120 N Zfp777 n/a
3 TRCN0000225775 ACATGATGGCATCGTGATTAA pLKO_005 1236 CDS 100% 13.200 9.240 N Zfp777 n/a
4 TRCN0000225773 ACGGCTGTGGAGTTCGCAAAT pLKO_005 823 CDS 100% 10.800 7.560 N Zfp777 n/a
5 TRCN0000255262 CAGACTGACAGTACTACTAAG pLKO_005 322 CDS 100% 10.800 7.560 N Zfp777 n/a
6 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1523 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.