Transcript: Mouse XM_006506720.3

PREDICTED: Mus musculus N-acetyltransferase 8 (GCN5-related) family member 4 (Nat8f4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nat8f4 (75541)
Length:
4866
CDS:
2377..3057

Additional Resources:

NCBI RefSeq record:
XM_006506720.3
NBCI Gene record:
Nat8f4 (75541)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506720.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114597 CCACAAGGTTAATGGGTCTTT pLKO.1 2984 CDS 100% 4.950 3.960 N Nat8f4 n/a
2 TRCN0000114600 GACCAGTACTTTGTGAGCATA pLKO.1 2962 CDS 100% 4.950 3.465 N Nat8f4 n/a
3 TRCN0000114598 GCTTTCTTGGAGAAATTACGT pLKO.1 2613 CDS 100% 3.000 2.100 N Nat8f4 n/a
4 TRCN0000114599 GTGACCATAGTCCTAGTGTCT pLKO.1 2527 CDS 100% 2.640 1.848 N Nat8f4 n/a
5 TRCN0000114611 GCACACACATACTTTCTGATT pLKO.1 4195 3UTR 100% 4.950 2.475 Y Nat8f2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506720.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.