Transcript: Mouse XM_006506757.3

PREDICTED: Mus musculus KRAB-A domain containing 1 (Krba1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Krba1 (77827)
Length:
3920
CDS:
90..3404

Additional Resources:

NCBI RefSeq record:
XM_006506757.3
NBCI Gene record:
Krba1 (77827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184755 CCCAAATGGATCAACTGCGAA pLKO.1 2821 CDS 100% 2.640 2.112 N Krba1 n/a
2 TRCN0000182973 CCTGATCTCAAGAACACTAAA pLKO.1 3775 3UTR 100% 13.200 9.240 N Krba1 n/a
3 TRCN0000183881 CAGAGGCTTCCTTGGTAGAAT pLKO.1 3070 CDS 100% 5.625 3.938 N Krba1 n/a
4 TRCN0000184427 GCTCTGATGGAGAAGACCTAA pLKO.1 2170 CDS 100% 4.950 2.970 N Krba1 n/a
5 TRCN0000183190 GTATCTTCCTTCTTACCTGTT pLKO.1 3507 3UTR 100% 4.050 2.430 N Krba1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.