Transcript: Mouse XM_006506948.3

PREDICTED: Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (Abcc9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcc9 (20928)
Length:
7536
CDS:
400..5040

Additional Resources:

NCBI RefSeq record:
XM_006506948.3
NBCI Gene record:
Abcc9 (20928)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102935 CGTGTGTTATAGGTTCATTTA pLKO.1 5185 3UTR 100% 13.200 18.480 N Abcc9 n/a
2 TRCN0000102938 CGACATATTTGACGGAAAGAT pLKO.1 4479 CDS 100% 5.625 7.875 N Abcc9 n/a
3 TRCN0000102937 GCGATTGGAAAGTTGCCGATA pLKO.1 1138 CDS 100% 4.050 5.670 N Abcc9 n/a
4 TRCN0000102939 GCCTTTATTACAAAGACGATA pLKO.1 829 CDS 100% 4.950 3.960 N Abcc9 n/a
5 TRCN0000102936 GCTGGCTATGATATACAATAA pLKO.1 1554 CDS 100% 13.200 9.240 N Abcc9 n/a
6 TRCN0000059277 GCTGTGGAGATCAATGTCATT pLKO.1 943 CDS 100% 4.950 3.465 N ABCC9 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5957 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.