Transcript: Mouse XM_006506963.2

PREDICTED: Mus musculus solute carrier organic anion transporter family, member 1b2 (Slco1b2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slco1b2 (28253)
Length:
3289
CDS:
180..2249

Additional Resources:

NCBI RefSeq record:
XM_006506963.2
NBCI Gene record:
Slco1b2 (28253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079890 CGTGGGTTTGAGTATAGCTTT pLKO.1 2042 CDS 100% 4.950 6.930 N Slco1b2 n/a
2 TRCN0000072840 CCACATTTCTTCATGGGATAT pLKO.1 513 CDS 100% 10.800 7.560 N SLCO1B7 n/a
3 TRCN0000079889 GCCCTCTCATTCAGCTACATA pLKO.1 270 CDS 100% 5.625 3.938 N Slco1b2 n/a
4 TRCN0000079892 GCCAACTTTCTGTTAGGAGTT pLKO.1 1284 CDS 100% 4.050 2.835 N Slco1b2 n/a
5 TRCN0000079891 GCCACATTTCTTCATGGGATA pLKO.1 512 CDS 100% 4.050 2.835 N Slco1b2 n/a
6 TRCN0000079888 CGGTTCTTTCACTGAGGAATT pLKO.1 2293 3UTR 100% 0.000 0.000 N Slco1b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.