Transcript: Mouse XM_006507016.3

PREDICTED: Mus musculus bicaudal D homolog 1 (Drosophila) (Bicd1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bicd1 (12121)
Length:
9451
CDS:
611..3535

Additional Resources:

NCBI RefSeq record:
XM_006507016.3
NBCI Gene record:
Bicd1 (12121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426634 TTCCTACCTACAGAATTTATT pLKO_005 3232 CDS 100% 15.000 10.500 N BICD1 n/a
2 TRCN0000200689 GCAACAAGATGCGATGAATAT pLKO.1 2855 CDS 100% 13.200 9.240 N Bicd1 n/a
3 TRCN0000191154 CTACAGAGAATACGAATGAAA pLKO.1 1055 CDS 100% 5.625 3.938 N Bicd1 n/a
4 TRCN0000191449 CTAGGTTTCTTCACTAAACAT pLKO.1 4135 3UTR 100% 5.625 3.938 N Bicd1 n/a
5 TRCN0000202374 GCCGTCACAGAAGTCATTGAT pLKO.1 1877 CDS 100% 5.625 3.938 N Bicd1 n/a
6 TRCN0000136849 CAGGTTGAATACGAAGGCTTA pLKO.1 1187 CDS 100% 4.050 2.835 N BICD1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6164 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.