Transcript: Mouse XM_006507378.3

PREDICTED: Mus musculus H6 homeobox 3 (Hmx3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hmx3 (15373)
Length:
3506
CDS:
1044..2114

Additional Resources:

NCBI RefSeq record:
XM_006507378.3
NBCI Gene record:
Hmx3 (15373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070728 CCGCGACCAGAAGCCTCGGAA pLKO.1 1431 CDS 100% 0.000 0.000 N Hmx3 n/a
2 TRCN0000070732 GCGCATCGTACGCGTGCCCAT pLKO.1 1946 CDS 100% 0.000 0.000 N Hmx3 n/a
3 TRCN0000434352 AGAGCCCGGACGAGATCATTC pLKO_005 1552 CDS 100% 3.600 2.880 N Hmx3 n/a
4 TRCN0000070731 CCGCTTTGAGATCCCAGCGCA pLKO.1 1325 CDS 100% 0.000 0.000 N Hmx3 n/a
5 TRCN0000070730 CGAGTCCACATTCGACATGAA pLKO.1 1769 CDS 100% 4.950 3.465 N Hmx3 n/a
6 TRCN0000413125 CATTCTGGAAGAGAGCGACTC pLKO_005 1568 CDS 100% 2.250 1.575 N Hmx3 n/a
7 TRCN0000418997 CACAAGGAGCTGGACTCCAAG pLKO_005 1533 CDS 100% 1.350 0.945 N Hmx3 n/a
8 TRCN0000015910 GCCCATCCTCTACCACGAGAA pLKO.1 1961 CDS 100% 1.350 0.945 N HMX3 n/a
9 TRCN0000070729 GCACCCAGTCTACTACTCGCA pLKO.1 2054 CDS 100% 0.220 0.154 N Hmx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.