Transcript: Mouse XM_006507696.3

PREDICTED: Mus musculus von Willebrand factor A domain containing 3A (Vwa3a), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vwa3a (233813)
Length:
4233
CDS:
145..3591

Additional Resources:

NCBI RefSeq record:
XM_006507696.3
NBCI Gene record:
Vwa3a (233813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507696.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092295 GCAGCTACTATCCATGAGAAA pLKO.1 1402 CDS 100% 4.950 6.930 N Vwa3a n/a
2 TRCN0000092294 GCCAAGAAGTTAAGTCTTTAT pLKO.1 1315 CDS 100% 13.200 9.240 N Vwa3a n/a
3 TRCN0000092297 CCTGACCAAGATGTGCACATA pLKO.1 1921 CDS 100% 4.950 3.465 N Vwa3a n/a
4 TRCN0000092293 CCTGCCATATAGCAGTCTCAT pLKO.1 3834 3UTR 100% 4.950 3.465 N Vwa3a n/a
5 TRCN0000092296 CGGCTCTCAGACAAAGGAATT pLKO.1 609 CDS 100% 0.000 0.000 N Vwa3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507696.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.