Transcript: Mouse XM_006507814.3

PREDICTED: Mus musculus TATA-box binding protein associated factor 10 (Taf10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Taf10 (24075)
Length:
683
CDS:
62..532

Additional Resources:

NCBI RefSeq record:
XM_006507814.3
NBCI Gene record:
Taf10 (24075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507814.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039353 TCGCAAGTACACCCTAACCAT pLKO.1 516 CDS 100% 3.000 4.200 N Taf10 n/a
2 TRCN0000039351 CTTGATGCAGTTGGAGGATTA pLKO.1 418 CDS 100% 10.800 7.560 N Taf10 n/a
3 TRCN0000014607 AGATGCAGTGACTGGTTACTA pLKO.1 454 CDS 100% 5.625 3.938 N TAF10 n/a
4 TRCN0000277978 AGATGCAGTGACTGGTTACTA pLKO_005 454 CDS 100% 5.625 3.938 N TAF10 n/a
5 TRCN0000039350 CTCAGCGAGTATGGCATCAAT pLKO.1 556 3UTR 100% 5.625 3.938 N Taf10 n/a
6 TRCN0000039352 CACACCTCTAGTGGACTTCTT pLKO.1 400 CDS 100% 4.950 3.465 N Taf10 n/a
7 TRCN0000055125 CGAGTATGGCATCAATGTGAA pLKO.1 561 3UTR 100% 4.950 3.465 N Taf10 n/a
8 TRCN0000055124 AGTGGACTTCTTGATGCAGTT pLKO.1 409 CDS 100% 4.050 2.835 N Taf10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507814.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.