Transcript: Mouse XM_006507840.2

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily r, polypeptide 1 (Cyp2r1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2r1 (244209)
Length:
1150
CDS:
79..1041

Additional Resources:

NCBI RefSeq record:
XM_006507840.2
NBCI Gene record:
Cyp2r1 (244209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414886 ATGTTCTATCCTGAGCGATTT pLKO_005 790 CDS 100% 10.800 15.120 N Cyp2r1 n/a
2 TRCN0000194000 GTTTAGATCTTGGAGGCATAT pLKO.1 311 CDS 100% 10.800 15.120 N Cyp2r1 n/a
3 TRCN0000175768 GCATATCAACTGTCGTTCTAA pLKO.1 326 CDS 100% 5.625 7.875 N Cyp2r1 n/a
4 TRCN0000193665 CCACATGAACTAGTTCCAAAT pLKO.1 955 CDS 100% 0.000 0.000 N Cyp2r1 n/a
5 TRCN0000215969 CATGGCCCTTTATCCTAATAT pLKO.1 510 CDS 100% 15.000 10.500 N Cyp2r1 n/a
6 TRCN0000193682 CCTTTGTTCATGAAGATGACA pLKO.1 415 CDS 100% 3.000 2.100 N Cyp2r1 n/a
7 TRCN0000174385 CTTCAGCAATTTCATTTGCAT pLKO.1 931 CDS 100% 3.000 2.100 N Cyp2r1 n/a
8 TRCN0000426259 ATGCAGTTGTACGTGGCTATT pLKO_005 692 CDS 100% 10.800 6.480 N Cyp2r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.