Transcript: Mouse XM_006507955.3

PREDICTED: Mus musculus stablizer of axonemal microtubules 2 (Saxo2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Saxo2 (330577)
Length:
3004
CDS:
137..1501

Additional Resources:

NCBI RefSeq record:
XM_006507955.3
NBCI Gene record:
Saxo2 (330577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264528 TACAAGTCATCGTCGAGATTA pLKO_005 748 CDS 100% 13.200 18.480 N Saxo2 n/a
2 TRCN0000264529 TACTGATATCTTCGGTTTATA pLKO_005 2119 3UTR 100% 15.000 12.000 N Saxo2 n/a
3 TRCN0000217044 CAAGTCATCGTCGAGATTATG pLKO.1 750 CDS 100% 13.200 10.560 N Saxo2 n/a
4 TRCN0000179118 CGGAAACTCAACTACATTTCA pLKO.1 637 CDS 100% 5.625 4.500 N Saxo2 n/a
5 TRCN0000217228 CCATACAGCAAGGACTATAAA pLKO.1 2367 3UTR 100% 15.000 10.500 N Saxo2 n/a
6 TRCN0000264530 TTGTCGCCAAGGACTTATTAA pLKO_005 1186 CDS 100% 15.000 10.500 N Saxo2 n/a
7 TRCN0000264526 ATTATAGATCTTGGGATATTC pLKO_005 561 CDS 100% 13.200 9.240 N Saxo2 n/a
8 TRCN0000264527 TGGACACTGTCCCAACTTATA pLKO_005 534 CDS 100% 13.200 9.240 N Saxo2 n/a
9 TRCN0000128153 CAAGATTATTCCTGCAGTGAA pLKO.1 1471 CDS 100% 4.950 3.465 N SAXO2 n/a
10 TRCN0000180152 CCCAGATGTGAAATTCGGAAA pLKO.1 622 CDS 100% 4.050 2.835 N Saxo2 n/a
11 TRCN0000108455 GCCCTTATGAAATAGTCAAAT pLKO.1 366 CDS 100% 13.200 6.600 Y Lrrc4c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.