Transcript: Mouse XM_006508057.3

PREDICTED: Mus musculus A kinase (PRKA) interacting protein 1 (Akip1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akip1 (57373)
Length:
676
CDS:
212..598

Additional Resources:

NCBI RefSeq record:
XM_006508057.3
NBCI Gene record:
Akip1 (57373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362733 CAACCCATGTCTACCGTTATC pLKO_005 285 CDS 100% 10.800 15.120 N Akip1 n/a
2 TRCN0000362732 TCAAGTCAGTGTGGGAAATAC pLKO_005 236 CDS 100% 13.200 10.560 N Akip1 n/a
3 TRCN0000306300 AGTCTACCCAGGGACCTATTC pLKO_005 626 3UTR 100% 10.800 8.640 N Akip1 n/a
4 TRCN0000306299 GACATCTGTTGGACAAGAAAG pLKO_005 382 CDS 100% 10.800 7.560 N Akip1 n/a
5 TRCN0000088490 GCAACCCATGTCTACCGTTAT pLKO.1 284 CDS 100% 10.800 7.560 N Akip1 n/a
6 TRCN0000088491 GTGGGAAATACTACTTGTCTA pLKO.1 246 CDS 100% 4.950 3.465 N Akip1 n/a
7 TRCN0000306301 TAGCTCTTCCTTCGGAGCAAT pLKO_005 193 5UTR 100% 4.950 3.465 N Akip1 n/a
8 TRCN0000088492 TGGGAAATACTACTTGTCTAT pLKO.1 247 CDS 100% 4.950 3.465 N Akip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.