Transcript: Mouse XM_006508212.1

PREDICTED: Mus musculus RIKEN cDNA 9030624J02 gene (9030624J02Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
9030624J02Rik (71517)
Length:
3589
CDS:
479..3394

Additional Resources:

NCBI RefSeq record:
XM_006508212.1
NBCI Gene record:
9030624J02Rik (71517)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174729 GAAACGTGATAAGGATGAGAA pLKO.1 862 CDS 100% 4.950 3.960 N 9030624J02Rik n/a
2 TRCN0000174397 CACGAGTGTTATTCAGTTCTA pLKO.1 1222 CDS 100% 4.950 3.465 N 9030624J02Rik n/a
3 TRCN0000194449 GAAGGCTCTGAAGATCGTCAT pLKO.1 1177 CDS 100% 4.050 2.835 N 9030624J02Rik n/a
4 TRCN0000173350 GCAGGATTATGTGAACCGCAT pLKO.1 1105 CDS 100% 2.160 1.512 N 9030624J02Rik n/a
5 TRCN0000136923 CCTGTTCTTGTGCAGTTGATT pLKO.1 2507 CDS 100% 5.625 3.938 N VPS35L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.