Transcript: Mouse XM_006508775.3

PREDICTED: Mus musculus tumor necrosis factor (ligand) superfamily, member 13b (Tnfsf13b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnfsf13b (24099)
Length:
2034
CDS:
639..1475

Additional Resources:

NCBI RefSeq record:
XM_006508775.3
NBCI Gene record:
Tnfsf13b (24099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379369 ACGCTAAGTCTCAGGATTTAC pLKO_005 1846 3UTR 100% 13.200 18.480 N Tnfsf13b n/a
2 TRCN0000066370 CTCGGGAGAATGCACAGATTT pLKO.1 1408 CDS 100% 13.200 18.480 N Tnfsf13b n/a
3 TRCN0000363413 GTGACCCTGTTCCGATGTATT pLKO_005 1296 CDS 100% 13.200 18.480 N Tnfsf13b n/a
4 TRCN0000363478 TTTCTCGTGACCCGTTGAATC pLKO_005 1583 3UTR 100% 10.800 15.120 N Tnfsf13b n/a
5 TRCN0000066372 CCACAGGAACAGACGCGCTTT pLKO.1 1001 CDS 100% 1.350 1.890 N Tnfsf13b n/a
6 TRCN0000066371 GTTCCGATGTATTCAGAATAT pLKO.1 1304 CDS 100% 13.200 10.560 N Tnfsf13b n/a
7 TRCN0000066369 GCTCCGAGAAAGGAGAAGATA pLKO.1 685 CDS 100% 5.625 3.938 N Tnfsf13b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.