Transcript: Mouse XM_006508817.2

PREDICTED: Mus musculus X-linked Kx blood group related 5 (Xkr5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xkr5 (319581)
Length:
2804
CDS:
507..2039

Additional Resources:

NCBI RefSeq record:
XM_006508817.2
NBCI Gene record:
Xkr5 (319581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257617 GTGTGCATCGCTGGTTATTTA pLKO_005 929 CDS 100% 15.000 21.000 N Xkr5 n/a
2 TRCN0000247221 TCCCTTGAGGCAACGTATATA pLKO_005 2456 3UTR 100% 15.000 21.000 N Xkr5 n/a
3 TRCN0000216773 GCTTAATCAGCTGCACTATTA pLKO.1 2529 3UTR 100% 13.200 18.480 N Xkr5 n/a
4 TRCN0000247220 GGTTCTGTTCTGCCGAGTTTA pLKO_005 599 CDS 100% 13.200 18.480 N Xkr5 n/a
5 TRCN0000247219 TGAGCTAACAAGTCTAGATAA pLKO_005 1115 CDS 100% 13.200 18.480 N Xkr5 n/a
6 TRCN0000217398 GAGCTAACAAGTCTAGATAAG pLKO.1 1116 CDS 100% 10.800 15.120 N Xkr5 n/a
7 TRCN0000173834 CGTGGCCAATATTAGTCCCAT pLKO.1 1784 CDS 100% 2.640 3.696 N Xkr5 n/a
8 TRCN0000247218 CTGTTACCGTGGCCAATATTA pLKO_005 1777 CDS 100% 15.000 10.500 N Xkr5 n/a
9 TRCN0000173968 GCTGGAGAACTCCATACTCTT pLKO.1 824 CDS 100% 4.950 3.465 N Xkr5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.