Transcript: Mouse XM_006508862.3

PREDICTED: Mus musculus ceramide synthase 4 (Cers4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cers4 (67260)
Length:
7217
CDS:
213..1394

Additional Resources:

NCBI RefSeq record:
XM_006508862.3
NBCI Gene record:
Cers4 (67260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337890 TCTTCTACACGCGCCTCATAT pLKO_005 1027 CDS 100% 13.200 18.480 N Cers4 n/a
2 TRCN0000337886 TGGTTGTGGTCGCCATCATTG pLKO_005 687 CDS 100% 10.800 15.120 N Cers4 n/a
3 TRCN0000337888 TACCTGCTGGAGGGTTGTAAG pLKO_005 942 CDS 100% 0.000 0.000 N Cers4 n/a
4 TRCN0000337887 TTGCCGCCAGCATTGTGAATA pLKO_005 1420 3UTR 100% 13.200 10.560 N Cers4 n/a
5 TRCN0000125384 CCAGTATTACTTAACGCAGAA pLKO.1 2120 3UTR 100% 4.050 3.240 N Cers4 n/a
6 TRCN0000337889 CTTTCACTGCTGATCACTTTG pLKO_005 783 CDS 100% 10.800 7.560 N Cers4 n/a
7 TRCN0000125386 GCGAATTGTCTTTGAGAGATT pLKO.1 368 CDS 100% 4.950 3.465 N Cers4 n/a
8 TRCN0000125385 GCTGTGGTACTGTTGTTGCAT pLKO.1 909 CDS 100% 3.000 2.100 N Cers4 n/a
9 TRCN0000125387 GCCCTTTGATGTCAAACGCAA pLKO.1 803 CDS 100% 2.640 1.848 N Cers4 n/a
10 TRCN0000125388 GCTACAGATTCTTCATGTGTA pLKO.1 1145 CDS 100% 4.950 2.970 N Cers4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.