Transcript: Mouse XM_006508880.1

PREDICTED: Mus musculus calmodulin regulated spectrin-associated protein family, member 3 (Camsap3), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camsap3 (69697)
Length:
4477
CDS:
514..4305

Additional Resources:

NCBI RefSeq record:
XM_006508880.1
NBCI Gene record:
Camsap3 (69697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182753 CGACGCATTGAGGCAATCTTT pLKO.1 2404 CDS 100% 5.625 4.500 N Camsap3 n/a
2 TRCN0000177579 CGAAGGCATCTATAAGTACAA pLKO.1 4149 CDS 100% 4.950 3.960 N Camsap3 n/a
3 TRCN0000197699 GCTGAGATGTATATGTGCTTT pLKO.1 1516 CDS 100% 4.950 3.960 N Camsap3 n/a
4 TRCN0000182145 CCTTAGAGGAAGAGGCATCTT pLKO.1 3149 CDS 100% 4.950 3.465 N Camsap3 n/a
5 TRCN0000176661 CTTCTCATTTGAGTGGACAAA pLKO.1 954 CDS 100% 4.950 3.465 N Camsap3 n/a
6 TRCN0000182463 GACTGGGAGAATGGAAGCAAT pLKO.1 3826 CDS 100% 4.950 3.465 N Camsap3 n/a
7 TRCN0000200287 GAGGCAATCTTTGCCAAGCAT pLKO.1 2413 CDS 100% 3.000 2.100 N Camsap3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 89 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.