Transcript: Mouse XM_006508980.3

PREDICTED: Mus musculus UBX domain protein 8 (Ubxn8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubxn8 (108159)
Length:
4987
CDS:
3515..4210

Additional Resources:

NCBI RefSeq record:
XM_006508980.3
NBCI Gene record:
Ubxn8 (108159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276890 ATCCCGAGTCTCGGCATTAAA pLKO_005 3590 CDS 100% 15.000 21.000 N Ubxn8 n/a
2 TRCN0000276932 TTGCGTCTACCTTACCATAAA pLKO_005 4520 3UTR 100% 13.200 18.480 N Ubxn8 n/a
3 TRCN0000198379 GACACTGTACTTAACGTGGAA pLKO.1 4166 CDS 100% 2.640 3.696 N Ubxn8 n/a
4 TRCN0000285807 GACACTGTACTTAACGTGGAA pLKO_005 4166 CDS 100% 2.640 3.696 N Ubxn8 n/a
5 TRCN0000217605 GAGAAGGCCAGCAGATATATA pLKO.1 3791 CDS 100% 15.000 10.500 N Ubxn8 n/a
6 TRCN0000285808 TTGCTGAGTGGCCGGATATTC pLKO_005 3620 CDS 100% 13.200 9.240 N Ubxn8 n/a
7 TRCN0000198360 GATGAAAGTTGGGTACCACAA pLKO.1 4057 CDS 100% 0.000 0.000 N Ubxn8 n/a
8 TRCN0000285806 GATGAAAGTTGGGTACCACAA pLKO_005 4057 CDS 100% 0.000 0.000 N Ubxn8 n/a
9 TRCN0000198547 GTTGGGTACCACAAATCCCTA pLKO.1 4064 CDS 100% 0.000 0.000 N Ubxn8 n/a
10 TRCN0000177593 CAGCAGGAAATGAAGTTGAAA pLKO.1 3830 CDS 100% 5.625 3.375 N Ubxn8 n/a
11 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 1481 5UTR 100% 13.200 6.600 Y Ptcra n/a
12 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 1489 5UTR 100% 2.640 1.320 Y Adsl n/a
13 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 1489 5UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.