Transcript: Mouse XM_006509111.3

PREDICTED: Mus musculus NIMA (never in mitosis gene a)-related expressed kinase 3 (Nek3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nek3 (23954)
Length:
2611
CDS:
674..2209

Additional Resources:

NCBI RefSeq record:
XM_006509111.3
NBCI Gene record:
Nek3 (23954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379019 TAACTCCTTTGATCCCAAATC pLKO_005 2436 3UTR 100% 10.800 15.120 N Nek3 n/a
2 TRCN0000376766 GTACGTGGGAACACCTTATTA pLKO_005 1150 CDS 100% 15.000 12.000 N Nek3 n/a
3 TRCN0000222253 CCCTGAAGACACGATACTTAA pLKO.1 964 CDS 100% 13.200 10.560 N Nek3 n/a
4 TRCN0000366002 ACACGATACTTAATTGGTTTA pLKO_005 972 CDS 100% 10.800 8.640 N Nek3 n/a
5 TRCN0000366077 GATCTGATGCAGAGGATTAAA pLKO_005 923 CDS 100% 15.000 10.500 N Nek3 n/a
6 TRCN0000374392 AGCATCCATTCCAGGCAAATA pLKO_005 1263 CDS 100% 13.200 9.240 N Nek3 n/a
7 TRCN0000374321 TCCAGAACCCTTGCGAGATTT pLKO_005 2310 3UTR 100% 13.200 9.240 N Nek3 n/a
8 TRCN0000222256 GCTGATCTCAGTCAGGCATTT pLKO.1 1934 CDS 100% 10.800 7.560 N Nek3 n/a
9 TRCN0000222255 GTAGCCATACTGAATTGGAAA pLKO.1 1620 CDS 100% 4.950 3.465 N Nek3 n/a
10 TRCN0000001472 CCTTATTATGTGCCTCCAGAA pLKO.1 1163 CDS 100% 4.050 2.835 N NEK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.