Transcript: Mouse XM_006509138.2

PREDICTED: Mus musculus RIKEN cDNA 6430573F11 gene (6430573F11Rik), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
6430573F11Rik (319582)
Length:
4034
CDS:
1088..2053

Additional Resources:

NCBI RefSeq record:
XM_006509138.2
NBCI Gene record:
6430573F11Rik (319582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125896 CGACGCTTTGAGAAACAGGAT pLKO.1 1154 CDS 100% 2.640 2.112 N 6430573F11Rik n/a
2 TRCN0000125894 CCTCCCAGTGATGAAATTATT pLKO.1 2324 3UTR 100% 15.000 10.500 N 6430573F11Rik n/a
3 TRCN0000125898 GAGAACGGATTGTATAGCAAT pLKO.1 1409 CDS 100% 4.950 3.465 N 6430573F11Rik n/a
4 TRCN0000125895 GCTGCTAGTAACAGCAGTGAT pLKO.1 1778 CDS 100% 0.495 0.347 N 6430573F11Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.