Transcript: Mouse XM_006509211.4

PREDICTED: Mus musculus glutamic-oxaloacetic transaminase 1-like 1 (Got1l1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Got1l1 (76615)
Length:
1618
CDS:
324..1538

Additional Resources:

NCBI RefSeq record:
XM_006509211.4
NBCI Gene record:
Got1l1 (76615)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509211.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103437 CGAAACTGATGTCCATCATTA pLKO.1 913 CDS 100% 13.200 18.480 N Got1l1 n/a
2 TRCN0000103438 GTGGACGAAACTGATGTCCAT pLKO.1 908 CDS 100% 0.264 0.211 N Got1l1 n/a
3 TRCN0000103436 CCAATCTCTGTCCAAGAATTT pLKO.1 1055 CDS 100% 13.200 9.240 N Got1l1 n/a
4 TRCN0000103435 CCTGACTGGAACGAAAGCTTT pLKO.1 1562 3UTR 100% 4.950 3.465 N Got1l1 n/a
5 TRCN0000152819 GAGCAAGCAGATATTCCCATT pLKO.1 935 CDS 100% 4.050 2.835 N GOT1L1 n/a
6 TRCN0000103439 GCCTGAAATCATTCATCCAGT pLKO.1 547 CDS 100% 2.640 1.848 N Got1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509211.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.