Transcript: Mouse XM_006509261.1

PREDICTED: Mus musculus a disintegrin and metallopeptidase domain 24 (testase 1) (Adam24), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adam24 (13526)
Length:
2830
CDS:
198..2483

Additional Resources:

NCBI RefSeq record:
XM_006509261.1
NBCI Gene record:
Adam24 (13526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431372 GACTATGTTGTAACCGCAAAT pLKO_005 1543 CDS 100% 10.800 15.120 N Adam24 n/a
2 TRCN0000032126 CCTAACGTCATAATTTGGTTA pLKO.1 2283 CDS 100% 4.950 6.930 N Adam24 n/a
3 TRCN0000421498 TGAAACCCTTGAGGGTAATTG pLKO_005 328 CDS 100% 13.200 10.560 N Adam24 n/a
4 TRCN0000430593 ATAAGCCAAGTTGGGTAAATG pLKO_005 2077 CDS 100% 13.200 9.240 N Adam24 n/a
5 TRCN0000032125 GCGGAGAAGAATCATGTTTAA pLKO.1 1273 CDS 100% 13.200 9.240 N Adam24 n/a
6 TRCN0000032127 GCATTGGTTATAGACCATGAA pLKO.1 834 CDS 100% 4.950 3.465 N Adam24 n/a
7 TRCN0000032124 GCTTCACTTCTTCAACTTCAA pLKO.1 2622 3UTR 100% 4.950 2.970 N Adam24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.