Transcript: Mouse XM_006509264.3

PREDICTED: Mus musculus acyl-CoA synthetase long-chain family member 1 (Acsl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acsl1 (14081)
Length:
4028
CDS:
785..2884

Additional Resources:

NCBI RefSeq record:
XM_006509264.3
NBCI Gene record:
Acsl1 (14081)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076069 CCGAAGATCTTGCGATAATTT pLKO.1 1587 CDS 100% 15.000 21.000 N Acsl1 n/a
2 TRCN0000334704 CCGAAGATCTTGCGATAATTT pLKO_005 1587 CDS 100% 15.000 21.000 N Acsl1 n/a
3 TRCN0000076072 CGACTTGTTGAAACTTGGGAA pLKO.1 2695 CDS 100% 2.640 3.696 N Acsl1 n/a
4 TRCN0000334706 CGACTTGTTGAAACTTGGGAA pLKO_005 2695 CDS 100% 2.640 3.696 N Acsl1 n/a
5 TRCN0000222618 CCTGTGGGATAAACTCATCTT pLKO.1 2017 CDS 100% 4.950 3.465 N Acsl1 n/a
6 TRCN0000334630 CCTGTGGGATAAACTCATCTT pLKO_005 2017 CDS 100% 4.950 3.465 N Acsl1 n/a
7 TRCN0000076071 GCTGATTGACATTCGGCAGTA pLKO.1 826 CDS 100% 4.050 2.835 N Acsl1 n/a
8 TRCN0000334629 GCTGATTGACATTCGGCAGTA pLKO_005 826 CDS 100% 4.050 2.835 N Acsl1 n/a
9 TRCN0000076068 CCCTTTAAGAACAACTGTCCA pLKO.1 3319 3UTR 100% 2.640 1.848 N Acsl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.