Transcript: Mouse XM_006509442.3

PREDICTED: Mus musculus dCMP deaminase (Dctd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dctd (320685)
Length:
1996
CDS:
196..750

Additional Resources:

NCBI RefSeq record:
XM_006509442.3
NBCI Gene record:
Dctd (320685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119759 CCGTGTAACGAATGTGCTAAA pLKO.1 538 CDS 100% 10.800 15.120 N Dctd n/a
2 TRCN0000119757 CCTTGGTTTGTTGGTCACATA pLKO.1 1429 3UTR 100% 4.950 6.930 N Dctd n/a
3 TRCN0000119760 GTTATCTTCATGTCGGATAAA pLKO.1 586 CDS 100% 1.320 1.848 N Dctd n/a
4 TRCN0000426773 TTGACTTTGATTCGATCAATA pLKO_005 704 CDS 100% 13.200 10.560 N Dctd n/a
5 TRCN0000413483 ATAATTGCTTCTCGTTCTTAG pLKO_005 1128 3UTR 100% 10.800 8.640 N Dctd n/a
6 TRCN0000427476 CTCTGTCATCCACCATATTTC pLKO_005 1064 3UTR 100% 13.200 9.240 N Dctd n/a
7 TRCN0000344022 TCATCATCCAGGCAGGTATAA pLKO_005 560 CDS 100% 13.200 9.240 N DCTD n/a
8 TRCN0000051876 AGCAAGATTGTCATTGACTTT pLKO.1 691 CDS 100% 4.950 3.465 N DCTD n/a
9 TRCN0000119758 GCTGGATACTAAATATCCTTA pLKO.1 435 CDS 100% 0.495 0.347 N Dctd n/a
10 TRCN0000119761 CCTTCTTGTCAGCACAAAGAA pLKO.1 281 CDS 100% 0.563 0.338 N Dctd n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 802 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000178741 CACACACATACACACACACAA pLKO.1 818 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.