Transcript: Mouse XM_006509494.3

PREDICTED: Mus musculus storkhead box 2 (Stox2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stox2 (71069)
Length:
9152
CDS:
229..2823

Additional Resources:

NCBI RefSeq record:
XM_006509494.3
NBCI Gene record:
Stox2 (71069)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190441 CGCAAACGATTGGTCATCAAA pLKO.1 1649 CDS 100% 5.625 7.875 N Stox2 n/a
2 TRCN0000202281 GCGCAAACGATTGGTCATCAA pLKO.1 1648 CDS 100% 4.950 6.930 N Stox2 n/a
3 TRCN0000200896 CAGCTATCACAAATCTAGCTT pLKO.1 2184 CDS 100% 0.300 0.420 N Stox2 n/a
4 TRCN0000189455 CGGAAACTCTCTCGAAACCTA pLKO.1 791 CDS 100% 3.000 2.400 N Stox2 n/a
5 TRCN0000135669 GACTATTACAACGTCTCTGAT pLKO.1 2356 CDS 100% 4.950 3.465 N STOX2 n/a
6 TRCN0000137938 GCCTCAGATCTTCTGTCTCAT pLKO.1 2834 3UTR 100% 4.950 3.465 N STOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.