Transcript: Mouse XM_006509534.3

PREDICTED: Mus musculus solute carrier family 18 (vesicular monoamine), member 1 (Slc18a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc18a1 (110877)
Length:
4028
CDS:
1793..3358

Additional Resources:

NCBI RefSeq record:
XM_006509534.3
NBCI Gene record:
Slc18a1 (110877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070052 CGGATAACTACGAGAGAGGAA pLKO.1 2442 CDS 100% 2.640 3.696 N Slc18a1 n/a
2 TRCN0000070049 CTTCTCAAAGATCCTTACATT pLKO.1 2669 CDS 100% 5.625 4.500 N Slc18a1 n/a
3 TRCN0000070048 CCAAGGCATTGGATCTTCATT pLKO.1 2380 CDS 100% 5.625 3.938 N Slc18a1 n/a
4 TRCN0000070051 CTCCACACTAATGTTTGCTTT pLKO.1 2320 CDS 100% 4.950 3.465 N Slc18a1 n/a
5 TRCN0000070050 GCTTTGCTATTGGCCCATCTA pLKO.1 3102 CDS 100% 4.950 3.465 N Slc18a1 n/a
6 TRCN0000044756 CCATAGGCATGGTGGATTCTT pLKO.1 2988 CDS 100% 5.625 3.938 N SLC18A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.