Transcript: Mouse XM_006509577.1

PREDICTED: Mus musculus myosin IXb (Myo9b), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo9b (17925)
Length:
7372
CDS:
267..6632

Additional Resources:

NCBI RefSeq record:
XM_006509577.1
NBCI Gene record:
Myo9b (17925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025943 CCCTTTAAGTTCCTGCCCATT pLKO.1 828 CDS 100% 4.050 5.670 N Myo9b n/a
2 TRCN0000025897 CCGTAAGATCACTAATGCCAA pLKO.1 4667 CDS 100% 2.640 3.696 N Myo9b n/a
3 TRCN0000362502 GAAGCAGCCTCAAGACTATTT pLKO_005 1331 CDS 100% 13.200 9.240 N Myo9b n/a
4 TRCN0000362422 GTGTTCCGTAAGATCACTAAT pLKO_005 4662 CDS 100% 13.200 9.240 N Myo9b n/a
5 TRCN0000362423 TCCCTATACAGTGCCCTATTT pLKO_005 1716 CDS 100% 13.200 9.240 N Myo9b n/a
6 TRCN0000025934 CCCAAAGATAAGGACAAGGAT pLKO.1 4014 CDS 100% 3.000 2.100 N Myo9b n/a
7 TRCN0000025882 CCAGAGAACCTTCCAGAGATT pLKO.1 7093 3UTR 100% 4.950 2.970 N Myo9b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.