Transcript: Mouse XM_006509629.1

PREDICTED: Mus musculus chondroitin sulfate N-acetylgalactosaminyltransferase 1 (Csgalnact1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csgalnact1 (234356)
Length:
3706
CDS:
471..2063

Additional Resources:

NCBI RefSeq record:
XM_006509629.1
NBCI Gene record:
Csgalnact1 (234356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110231 CGGTCAGACTTCATCAACATA pLKO.1 1752 CDS 100% 5.625 7.875 N Csgalnact1 n/a
2 TRCN0000110233 CCGGAAATATCTCCATAGCAA pLKO.1 1826 CDS 100% 3.000 4.200 N Csgalnact1 n/a
3 TRCN0000110230 CCCGAGATAAACTTGAAATTA pLKO.1 2761 3UTR 100% 15.000 10.500 N Csgalnact1 n/a
4 TRCN0000000318 AGCTGGTCATAAAGAAGGAAA pLKO.1 1687 CDS 100% 4.950 3.465 N CSGALNACT1 n/a
5 TRCN0000110234 CAGCATCGTAACTATGTGAAT pLKO.1 663 CDS 100% 4.950 3.465 N Csgalnact1 n/a
6 TRCN0000110232 CGAAAGGGATAAAGGCACTTT pLKO.1 1112 CDS 100% 4.950 3.465 N Csgalnact1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.